j5indyPanzie j5indyPanzie

01-02-2017
History

contestada

When was declaration of independence signed?

Respuesta :

jaimekirkpatrick jaimekirkpatrick

01-02-2017

It was signed on July 4, 1776

Answer Link

kyliemo2003 kyliemo2003

01-02-2017

The Declaration of Independence was signed by most of the delegates on August 2, 1776, but several signed on a later date.

Answer Link

Otras preguntas

How could fossils of plants be found on an island in the Arctic Ocean? 1.The island must have had a warm climate to support the plants. 2.The plants must have

What mass of iron is formed when 240 g of iron(III) oxide reacts completely with carbon monoxide?

30 POINTS WILL GIVE BRAINLIEST Brainstorm some ideas for a “hook” for your essay against online school.

Which principle of government does this article BEST demonstrate?

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

i need help lol if you can do this for me that would be amazing. its long and 20 Q.

1. In triangle ABC, the measure of ∠ABC is 42°, and the measure of ∠BCA is 113º. What is the measure of ∠CAB? How do you know that is the answer?

The graph below displays the cost of notebooks. How many notebooks can you purchase for $108.00?

What was one way "old" immigrants. differed fr. m "new" immigrants in the 1800s?

prepare a list of the reason of flooding