jennagoodmanrobinson jennagoodmanrobinson

04-03-2021
Mathematics

contestada

The product of 3 and b
divided by 12

Respuesta :

345frfdfsdfgagf 345frfdfsdfgagf

05-03-2021

Answer:

Standard form: 1/4b

Evaluate : b/4

Step-by-step explanation:

Answer Link

Otras preguntas

Can someone plz write a story about literally anything, about a paragraph long, using ALL of these words? Thxxxxxxxxx ;) adapt attest dovetail enormity falter f

Please look at the image , they all need to be factored using DOTS moi

Cryolite, Na 3 AlF 6 ( s ) , Na3AlF6(s), an ore used in the production of aluminum, can be synthesized using aluminum oxide. Balance the equation for the synthe

John goel is to have more then -7 dollors in hisaccount by the end of this mounth. the varible d is the nuber of dollor in johns bank account at the end of the

what nation does the us support in the middle east since the creation in 1948- 50 points

How do I solve 8-b÷4=5?

Find the least common multiple of 18 and 24.

The length of a rectangle is twice as long as the width. The area is 200 ft2. What is the the length and the width of the rectangle.

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Find the slope (-8, 18) and (-14, -3)