rcsmlove17 rcsmlove17
  • 03-03-2021
  • Mathematics
contestada

plzzz help meee giving 50 pointsssssssss

plzzz help meee giving 50 pointsssssssss class=

Respuesta :

sgwheat31
sgwheat31 sgwheat31
  • 03-03-2021

Answer:

it is 37.68

it is 37.68 ........

Ver imagen sgwheat31
Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
help me out someone plss
Write the equation in slope-intercept form. 13x + 10y = 4
Help me with this question
The endpoints of DE and D(-3, y) and x, 6). The midpoint of DE is M(4,2). What is the length of DE.
which type of encoding involves relating new information to existing knowledge that you already have stored in long-term memory?
Describe a situation in which you may experience bypass.
During your research on a topic, you run across a blog site where several people posted that fuel prices have gone up 10% in the last six months. You can provid
What does 4^8/4^-2 equal?
Several educational centers and universities were founded to