monkeybrain1s
monkeybrain1s monkeybrain1s
  • 03-11-2020
  • Mathematics
contestada

Whats 1+1 please help Idk What to do im gona fail. please Help IM timed

Whats 11 please help Idk What to do im gona fail please Help IM timed class=

Respuesta :

dwafwaf dwafwaf
  • 03-11-2020

Answer:

11

Step-by-step explanation:

1+1=11

Answer Link
vdhharlei
vdhharlei vdhharlei
  • 03-11-2020

Answer:

2 because its simple

Answer Link

Otras preguntas

Which of the following best describes the central idea of the article? A The Tuskegee Airmen started the Civil Rights Movement by proving that black pilots are
99999+ 10000 what if it impossible​
What force is required to move an object 8 m using 24 j of work?
Which conflict management strategy involves choosing not to deal with the issues or the people involved and retreating from the situation hoping it either goes
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
PLEASE ANSWER a seed was discovered and when planted grew to be a large flower. A) archaea B) bacteria C) Eukarya
PLS HELP WITH QUESTION
A fish in an aquarium with flat sides looks out at a hungry cat. To the fish, the distance to the cat appears to be A fish in an aquarium with flat sides looks
Re-write the Spanish sentence by replacing the direct object noun with a direct object pronoun. Yo compro la tarjeta postal. Ellos preparan las maletas. Tú lla
What are three causes that led to the civil war?